Journal: Molecules

Article Title: Inhibitory Effects of Selected Medicinal Plants on Bacterial Growth of Methicillin-Resistant Staphylococcus aureus

doi: 10.3390/molecules27227780

Figure Lengend Snippet: Antibiotic resistance profiles of S. aureus strains used in the present study.

Article Snippet: MRSA ATCC 33,591 , MRSA , Amp, Pen, Kan, Eryth, Strep, Tet, Gen, Chlo, Meth.

Techniques:

Journal: Molecules

Article Title: Inhibitory Effects of Selected Medicinal Plants on Bacterial Growth of Methicillin-Resistant Staphylococcus aureus

doi: 10.3390/molecules27227780

Figure Lengend Snippet: Antibacterial activities of ethanol extracts from selected medicinal plants against S. aureus strains.

Article Snippet: MRSA ATCC 33,591 , MRSA , Amp, Pen, Kan, Eryth, Strep, Tet, Gen, Chlo, Meth.

Techniques: Concentration Assay

Journal: Molecules

Article Title: Inhibitory Effects of Selected Medicinal Plants on Bacterial Growth of Methicillin-Resistant Staphylococcus aureus

doi: 10.3390/molecules27227780

Figure Lengend Snippet: Antibacterial activities of fractions from selected medicinal plants against S. aureus strains.

Article Snippet: MRSA ATCC 33,591 , MRSA , Amp, Pen, Kan, Eryth, Strep, Tet, Gen, Chlo, Meth.

Techniques: Concentration Assay

Journal: Molecules

Article Title: Inhibitory Effects of Selected Medicinal Plants on Bacterial Growth of Methicillin-Resistant Staphylococcus aureus

doi: 10.3390/molecules27227780

Figure Lengend Snippet: Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of ethanol extracts and fractions from selected medicinal plants against S. aureus strains.

Article Snippet: MRSA ATCC 33,591 , MRSA , Amp, Pen, Kan, Eryth, Strep, Tet, Gen, Chlo, Meth.

Techniques: Concentration Assay

Journal: Molecules

Article Title: Inhibitory Effects of Selected Medicinal Plants on Bacterial Growth of Methicillin-Resistant Staphylococcus aureus

doi: 10.3390/molecules27227780

Figure Lengend Snippet: Antibacterial parameters of ethanol extracts and fractions from selected medicinal plants against MRSA strains.

Article Snippet: MRSA ATCC 33,591 , MRSA , Amp, Pen, Kan, Eryth, Strep, Tet, Gen, Chlo, Meth.

Techniques:

Journal: Molecules

Article Title: Inhibitory Effects of Selected Medicinal Plants on Bacterial Growth of Methicillin-Resistant Staphylococcus aureus

doi: 10.3390/molecules27227780

Figure Lengend Snippet: Influence of ethanol extracts from selected medicinal plants on bacterial growth of MRSA 33,591 and CI-2.

Article Snippet: MRSA ATCC 33,591 , MRSA , Amp, Pen, Kan, Eryth, Strep, Tet, Gen, Chlo, Meth.

Techniques:

Journal: Molecules

Article Title: Inhibitory Effects of Selected Medicinal Plants on Bacterial Growth of Methicillin-Resistant Staphylococcus aureus

doi: 10.3390/molecules27227780

Figure Lengend Snippet: Influence of fractions from selected medicinal plants on bacterial growth of MRSA 33,591 and CI-2.

Article Snippet: MRSA ATCC 33,591 , MRSA , Amp, Pen, Kan, Eryth, Strep, Tet, Gen, Chlo, Meth.

Techniques:

Journal: Brazilian Journal of Microbiology

Article Title: Virulence factors and antimicrobial resistance in Staphylococcus aureus isolated from bovine mastitis in Brazil

doi: 10.1007/s42770-020-00363-5

Figure Lengend Snippet: Antimicrobial resistance genes investigated in resistant Staphylococcus aureus isolated from bovine mastitis in this study by PCR

Article Snippet: Agarose gel electrophoresis for PCR products was performed as described in Section Identification of S.aureus . table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 Target Gene Primer sequence (5′ to 3′) Amplicon size (bp) a Positive control b Reference β-Lactam resistance blaZ F CAGTTCACATGCCAAAGAG R TACACTCTTGGCGGTTTC 772 60 [ 31 ] Macrolide resistance—rRNA erm methylase erm(A) F TCTAAAAAGCATGTAAAAGAA R CTTCGATAGTTTATTAATATTAG 645 75, 76, 78 [ 32 ] Macrolide resistance—rRNA erm methylase erm(B) F GAAAAGTACTCAACCAAATA R AGTAACGGTACTTAAATTGTTTA 639 76, 60 [ 32 ] Macrolide resistance—rRNA erm methylase erm(C) F TCAAAACATAATATAGATAAA R GCTAATATTGTTTAAATCGTCAAT 642 184, 398 [ 32 ] Macrolide/lincosamide/streptogramin B (MLSB) resistance erm(T) F CCGCCATTGAAATAGATCCT R TTCTGTAGCTGTGCTTTCAAAAA 200 161 [ 33 ] Macrolide resistance—rRNA erm methylase erm(Y) F AGGCCCCTTTTAAAGACGAAGGCA R GGCGCGATTGTTCATTTTAAGGCCC 320 60 [ 33 ] Macrolide resistance—efflux pump msr(A) F GGCACAATAAGAGTGTTTAAAGG R AAGTTATATCATGAATAGATTGTCCTGTT 940 60, 352 [ 9 ] Macrolide resistance—macrolide phosphotransferase mph(C) F ATGACTCGACATAATGAAAT R CTACTCTTTCATACCTAACTC 900 60, 352 [ 31 ] Tetracycline resistance (efflux pump) tet(L) F CATTTGGTCTTATTGGATCG R ATTACACTTCCGATTTCGG 456 240 [ 34 ] Tetracycline resistance (efflux pump) tet(K) F TTAGGTGAAGGGTTAGGTCC R GCAAACTCATTCCAGAAGCA 697 184, 82 [ 34 ] Tetracycline resistance (ribosomal protection) tet(M) F GTTAAATAGTGTTCTTGGAG R CTAAGATATGGCTCTAACAA 657 75, 78 [ 34 ] Aminoglycoside resistance—aminoglycoside-modifying enzyme (AME) aac(6′ -Ie–aph(2′)-Ia F CAGAGCCTTGGGAAGATGAAG R CCTCGTGTAATTCATGTTCTGGC 348 137, 386 [ 35 ] Fluoroquinolone resistance (efflux pump) mepA F ATGTTGCTGCTGCTCTGTTC R TCAACTGTCAAACGATCACG 718 ATCC c 33,591 [ 36 ] Fluoroquinolone resistance (topoisomerase IV mutation) grlA F TGCCAGATGTTCGTGATGGT R TGGAATGAAAGAAACTGTCTC 339 ATCC 33591 [ 37 ] Fluoroquinolone resistance (DNA gyrase mutation) gyrA F TCGTGCATTGCCAGATGTTCG R TCGAGCAGGTAAGACTGACGG 394 ATCC 33591 [ 37 ] Open in a separate window a Base pairs (bp) b Strains used as positive controls were from the collection of the Laboratório de Bacteriologia, Departamento de Medicina Veterinária, Universidade Federal de Lavras [ 60 ] c American Type Culture Collection (ATCC) Antimicrobial resistance genes investigated in resistant Staphylococcus aureus isolated from bovine mastitis in this study by PCR Multidrug resistance was defined as resistance to three or more antimicrobial class.

Techniques: Isolation, Sequencing, Amplification, Positive Control, Mutagenesis

Journal: Molecules

Article Title: The Methylene-Cycloalkylacetate (MCA) Scaffold in Terpenyl Compounds with Potential Pharmacological Activities

doi: 10.3390/molecules24112120

Figure Lengend Snippet: Halim-5-enes.

Article Snippet: Micromonohalimane A, 70 , Micromonospora sp. , Methicillin-resistant Staphylococcus aureus (MR SA ) ATCC 33,591 (MIC > 200 μg/mL) , [ ] .

Techniques: Activity Assay, Inhibition

Journal: Molecules

Article Title: The Methylene-Cycloalkylacetate (MCA) Scaffold in Terpenyl Compounds with Potential Pharmacological Activities

doi: 10.3390/molecules24112120

Figure Lengend Snippet: Secohalimanes and 4-enes.

Article Snippet: Micromonohalimane A, 70 , Micromonospora sp. , Methicillin-resistant Staphylococcus aureus (MR SA ) ATCC 33,591 (MIC > 200 μg/mL) , [ ] .

Techniques: Activity Assay